Maltoporin

Author: kwva

August undefined, 2024

WebWe have determined the sequence of the lamB gene from Klebsiella pneumoniae. It encodes the precursor to the LamB protein, a 429 amino acid polypeptide with maltoporin function. Comparison with the Escherichia coli LamB protein reveals a high degree of homology, with 325 residues strictly identical. The N-terminal third of the protein is the … WebMaltoporin appears to be constituted by three different domains: a major rod-like domain spanning the membrane, a minor domain located near the periplasmic surface of the …

A New Strain Collection for Improved Expression of Outer …

WebNational Center for Biotechnology Information WebMar 21, 1997 · Maltoporin (LamB) facilitates the diffusion of maltodextrins across the outer membrane of E. coli. The structural basis for the specificity of the channel is investigated … seaview marina longport

Prediction of membrane-spanning beta-strands and its …

WebFeb 1, 1996 · Background: Maltoporin (which is encoded by the lamB gene) facilitates the translocation of maltodextrins across the outer membrane of E. coli. In particular, it is … WebMaltoporins (or LamB porins) are bacterial outer membrane proteins of the porin family. Maltoporin forms a trimeric structure which facilitates the diffusion of maltodextrins … WebThe maltoporin LamB of Escherichia coli K12 is a trimeric protein which facilitates the diffusion of maltose and maltodextrins through the bacterial outer membrane, and also acts as a non-specific porin for small hydrophilic molecules as well as a receptor for phages. seaview marine resort

Cysteine-22 and cysteine-38 are not essential for the functions of ...

RCSB PDB - 1AF6: MALTOPORIN SUCROSE COMPLEX

WebThe lining of the maltodextrin-specific maltoporin (LamB) channel exhibits a string of aromatic residues, the greasy slide, part of which has been shown previously by … WebThe maltoporin channel is asymmetric and, added from one side only, predominantly inserts in an oriented manner. The asymmetry of the channel structure manifests itself in … pull out spice upper cabinetWebA polypeptide hormone secreted by the intermediate lobe of the hypophysis in humans (in neurohypophysis in certain other species), that causes dispersion of melanin by … pull out storage tool box

"WebFeb 1, 2002 · Maltoporin was first identified as the receptor for λ -phage in E. coli ( Randall-Hazelbauer and Schwartz, 1973 ). It was shown that this membrane protein is induced during growth on maltodextrins and is involved in the maltose transport ( Szmelcman and Hofnung, 1975 ). " - Maltoporin

Maltoporin

WebFeb 21, 2024 · stomach cramps or bloating; headache; or. pain, swelling, or warmth where the medicine was injected. This is not a complete list of side effects and others may … WebFeb 7, 1997 · The maltodextrin-specific (malto-)porin from Salmonella typhimurium has been crystallized. Its three-dimensional structure was determined at 2.4 A resolution (1 A = 0.1 nm).

Did you know?

WebFeb 1, 1996 · Results The crystal structures of maltoporin in complex with maltose, maltotriose and maltohexaose reveal an extended binding site within the maltoporin channel. The maltooligosaccharides are in apolar van der Waals contact with the ‘greasy slide’, a hydrophobic path that is composed of aromatic residues and located at the … WebThus, different ways to prevent and control A. hydrophila infection need to be explored, including a vaccine. In this study, we evaluated the protective efficacy of an oral vaccine prepared from the A. hydrophila TPS maltoporin (Malt) with Lactobacillus plantarum (L. plantarum) against A. hydrophila infection in crucian carp (Carassius auratus).

WebMar 2, 2005 · One of them, maltoporin, is a passive specific channel for the maltodextrin uptake. This channel was also named LamB as the bacterial virus phage Lambda mis-uses this channel to recognise the bacteria. The first step is a reversible binding followed after a lag phase by DNA injection.

WebMaltoporin Details Name Maltoporin Synonyms Lambda receptor protein malB Maltose-inducible porin Gene Name lamB Organism Escherichia coli (strain K12) Amino acid … WebMaltodextrin is a type of carbohydrate, but it undergoes intense processing. It comes in the form of a white powder from rice, corn, wheat, or potato starch. Its makers first cook it, …

WebLocus tag: KPN_04425 Name: lamB Funciton: maltoporin Locus tag: KPN_04426 Name: malM Funciton: maltose regulon periplasmic protein malK-lamB-malM-254: 4.5: TTGTGTGATCTCCATTGCAAAA: KPN_04424-225: 3.7: TATTGCGTCCTGGAGCACAGAA: Photorhabdus luminescens subsp. laumondii TTO1 Position ...

WebJan 27, 1995 · The crystal structure of maltoporin from Escherichia coli, determined to a resolution of 3.1 angstroms, reveals an 18-stranded, antiparallel β-barrel that forms the … seaview marine seattleWebOct 5, 2012 · The LamB protein is a well-characterized example of a porin, termed as a maltoporin, because it is required for growth on limiting concentrations of maltose. The protein coded by gene lamB of the maltose operon also serves as receptors for several phages, such as λ, K10 and TP1 [ 48 , 49 , 50 ]. pull out strength of anchor boltsWebMaltoporin Gene lamB Status UniProtKB reviewed (Swiss-Prot) Organism Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) Amino acids 452 Protein existence … pull out storage headboardWebMay 1, 1988 · Maltoporin (LamB protein) is a maltodextrin transport protein in the outer membrane of Escherichia coli with binding sites for bacteriophage lambda and maltosaccharides. Binding of starch by... seaview marine services ocean view njWebJan 11, 1996 · Maltoporin (which is encoded by the lamB gene) facilitates the translocation of maltodextrins across the outer membrane of E. coli. In particular, it is indispensable for … pull out strength of threads in aluminumWebNov 7, 2024 · Maltoporin (LamB) has a size of ~49 kDa. OmpC and OmpF are approximately the same size and run as a single band at ~39 kDa, and OmpA has the smallest size of ~35 kDa. All of these protein bands are visible in the parent strain. The single knock-out strain BL21ΔA shows all bands of interest except the 35 kDa OmpA … seaview marine servicesWebMay 1, 2024 · Maltoporin, as a family of outer membrane proteins, has been shown to have good immunogenicity and protective effect in immunizing rohu (Labeo rohita) [14] and zebrafish (Danio rerio) [6]. However, the information of maltoporin as a common antigen among different serotypes of A. hydrophila is still not available in aquaculture. seaview marriott brunch